Internal ID | 1426506 | Source Database | PseudoCAP 1426506 |
Feature Type | motif |
Name |
ExsA binding site 2
|
Sequence |
GACGGCCGCCAACAGTAAAAA Look for more occurrences |
Start | 58687 |
End | 58707 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
EMSA
|
Additional Comments |
Xref | PseudoCAP:PA1713 |
The distal ExsA-binding site in Pseudomonas aeruginosa type III secretion system promoters is the primary determinant for promoter-specific properties.
Brutinel ED, King JM, Marsden AE, Yahr TL
J. Bacteriol. 2012 May;194(10):2564-72
PubMed ID: 22408165
|