| Internal ID | 1572022 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
PvdS binding site
|
| Sequence |
TAAACCGGCCTGGCGCAGCATCGT Look for more occurrences |
| Start | 1226334 |
| End | 1226357 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,Site directed mutagenesis,EMSA,DNAse footprinting,Multiple sequence alignment (MSA),Consensus search,Isothermal titration calorimetry
|
| Additional Comments |