| Internal ID | 17655716 | Source Database | TransTermHP TERM 179 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 179
|
| Sequence |
GGGGCGGCGGCCGCGCCGTCCC Look for more occurrences |
| Start | 799251 |
| End | 799272 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATGCCGGGAAGGAAA(5' tail) GGGACGGCG(5' stem) CGGC(loop) CGCCGCCCC(3' stem) GGCGGTTCATTTGAG(3' tail). Confidence: 91. opp_overlap 799260 799263, overlap 799255 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|