Internal ID | 17655757 | Source Database | TransTermHP TERM 243 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 243
|
Sequence |
GGGCCTGCATTGCTGCAGGCCC Look for more occurrences |
Start | 991741 |
End | 991762 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGCGCCATACCGAAA(5' tail) GGGCCTGCA(5' stem) GCAA(loop) TGCAGGCCC(3' stem) TTTTTCTTTGCCCGG(3' tail). Confidence: 90. opp_overlap 991741 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|