Internal ID | 17655763 | Source Database | TransTermHP TERM 249 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 249
|
Sequence |
ACGCGCCCAATCGGGCGCGC Look for more occurrences |
Start | 1001937 |
End | 1001956 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTCCGCTGCAAAAAA(5' tail) GCGCGCCC(5' stem) GATT(loop) GGGCGCGT(3' stem) TTTTTTGCGCGTTTC(3' tail). Confidence: 100. opp_overlap 1001925 1001938, overlap 1001938 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|