| Internal ID | 17657244 | Source Database | TransTermHP TERM 1061 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1061
|
| Sequence |
GGGCCTGCATTGCTGCAGGCCC Look for more occurrences |
| Start | 4659829 |
| End | 4659850 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGCAAAAAAAAAG(5' tail) GGGCCTGCA(5' stem) TTGC(loop) TGCAGGCCC(3' stem) TTTCGGTATGGCGCA(3' tail). Confidence: 90. opp_overlap 4659829 4659828 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|