| Internal ID | 17654912 | Source Database | TransTermHP TERM 538 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 538
|
| Sequence |
GAACCCGCCCTCGAGGCGGGTTC Look for more occurrences |
| Start | 2006719 |
| End | 2006741 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCAGCGTCCACTCC(5' tail) GAACCCGCC(5' stem) CTCGA(loop) GGCGGGTTC(3' stem) TTCGTTCTGTCTCCT(3' tail). Confidence: 90. overlap 2006722 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|