Internal ID | 17655666 | Source Database | TransTermHP TERM 106 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 106
|
Sequence |
CCCGGATGGAAGCATCCGGG Look for more occurrences |
Start | 515010 |
End | 515029 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCCAGCCCGAAGAA(5' tail) CCCGGATG(5' stem) GAAG(loop) CATCCGGG(3' stem) TTTTTTATTGCCCGG(3' tail). Confidence: 100. opp_overlap 514985 515010 515024 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|