Internal ID | 17655768 | Source Database | TransTermHP TERM 258 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 258
|
Sequence |
CCGTGGCAGCCCGGCTGCCACGG Look for more occurrences |
Start | 1026243 |
End | 1026265 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTAATGGGAAAATTA(5' tail) CCGTGGCAGC(5' stem) CGG(loop) GCTGCCACGG(3' stem) CATCTGAATCAGCCG(3' tail). Confidence: 93. overlap 1026240 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|