Internal ID | 17655788 | Source Database | TransTermHP TERM 293 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 293
|
Sequence |
CGGGGGCGTCGAAGCCCCCG Look for more occurrences |
Start | 1127623 |
End | 1127642 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGGCGCGGAGCAGAA(5' tail) CGGGGGC(5' stem) GTCGAA(loop) GCCCCCG(3' stem) TTTTCGTTCATGGCT(3' tail). Confidence: 100. opp_overlap 1127623 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|