| Internal ID | 17656648 | Source Database | TransTermHP TERM 102 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 102
|
| Sequence |
CCCGGTTCGCAGCGCAATCCAGGG Look for more occurrences |
| Start | 484692 |
| End | 484715 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGCGCCTTGCGCTT(5' tail) CCC-GGTTCGC(5' stem) AGC(loop) GCAATCCAGGG(3' stem) TTTTTTCTTAGCCTG(3' tail). Confidence: 91. gap 1, overlap 484692 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|