| Internal ID | 17656693 | Source Database | TransTermHP TERM 164 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 164
|
| Sequence |
CGCCGCGCATATAAGCGCGGCG Look for more occurrences |
| Start | 728595 |
| End | 728616 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGCCGCTACGAAAA(5' tail) CGCCGCGC(5' stem) TTATAT(loop) GCGCGGCG(3' stem) TTTTCGTTTCAGGCG(3' tail). Confidence: 100. opp_overlap 728584 728595 728589 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|