Internal ID | 17657257 | Source Database | TransTermHP TERM 1075 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1075
|
Sequence |
GCGCCAGGCTGTCGCCTGGCGG Look for more occurrences |
Start | 4711758 |
End | 4711779 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AATATACGAGAAAAA(5' tail) CCGCCAGGC(5' stem) GACA(loop) GCCTGGCGC(3' stem) CTCACATCTGTTGCA(3' tail). Confidence: 100. overlap 4711759 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|