Motif View

Internal ID 17683778
Source Database TransTermHP TERM 21
Feature Type terminator
Name
Rho-independent transcription terminator TERM 21
Sequence GGGTCGTCCGTCGCGTCCGCCGGGCGCCATGGCCGACCC
Look for more occurrences
Start 105012
End 105050
Strand +
Genomic Context Located within gene [M062_00445]
Replicon Pseudomonas aeruginosa RP73, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments GTACTGAATTCCACC(5' tail) GGGTCGTCCGTCGCGTCC(5' stem) GCC(loop) GGGCGCCATGGCCGACCC(3' stem) TTCATTCGCATCCGG(3' tail). Confidence: 93.

Reference

Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685