| Internal ID | 1426505 | Source Database | PseudoCAP 1426505 |
| Feature Type | motif |
| Name |
ExsA binding site I
|
| Sequence |
CACGGCCAATCCTGATAGGC Look for more occurrences |
| Start | 58711 |
| End | 58730 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
EMSA
|
| Additional Comments |
| Xref | PseudoCAP:PA1713 |
|
The distal ExsA-binding site in Pseudomonas aeruginosa type III secretion system promoters is the primary determinant for promoter-specific properties.
Brutinel ED, King JM, Marsden AE, Yahr TL
J. Bacteriol. 2012 May;194(10):2564-72
PubMed ID: 22408165
|