| Internal ID | 17654910 | Source Database | TransTermHP TERM 536 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 536
|
| Sequence |
CCGGCGCCCACTGCCTGGGCGCCGG Look for more occurrences |
| Start | 2005509 |
| End | 2005533 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCAGGCCATGGAAG(5' tail) CCGGCGCCCA(5' stem) CTGCC(loop) TGGGCGCCGG(3' stem) TTCTTCCCGGCGATT(3' tail). Confidence: 100. opp_overlap 2005508, overlap 2005497 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|