| Internal ID | 17655628 | Source Database | TransTermHP TERM 47 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 47
|
| Sequence |
CGCCCGATGCGGTGCATCGGGCG Look for more occurrences |
| Start | 288390 |
| End | 288412 |
| Strand | - |
| Genomic Context | Located within gene [PA0257] |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGATAGGCCTCAAAA(5' tail) CGCCCGATGC(5' stem) ACC(loop) GCATCGGGCG(3' stem) TTTTGTTTTTCAGGG(3' tail). Confidence: 100. opp_overlap 288390 288385 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|