| Internal ID | 17655984 | Source Database | TransTermHP TERM 598 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 598
|
| Sequence |
GCCCGGCCATCGAGCCGGGC Look for more occurrences |
| Start | 2806310 |
| End | 2806329 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCGCCCACGAAAAA(5' tail) GCCCGGC(5' stem) TCGATG(loop) GCCGGGC(3' stem) TCTTTCGCTGCGGGT(3' tail). Confidence: 100. opp_overlap 2806310 2806308, overlap 2806294 2806295 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|