Internal ID | 17656112 | Source Database | TransTermHP TERM 795 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 795
|
Sequence |
CGAGGCCCGCCCAGTTGCGGGCCTCG Look for more occurrences |
Start | 3515366 |
End | 3515391 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCCTCCCCCAAAAA(5' tail) CGAGGCCCGC(5' stem) AACTGG(loop) GCGGGCCTCG(3' stem) TCATCGACTGTGGGA(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|