| Internal ID | 17656424 | Source Database | TransTermHP TERM 1279 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1279
|
| Sequence |
GCGCCTGGCCATGCCGGGCGC Look for more occurrences |
| Start | 5291551 |
| End | 5291571 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTGCCCCCATACCCA(5' tail) GCGCCTGGC(5' stem) CAT(loop) GCCGGGCGC(3' stem) TTTCCATGCCACAGG(3' tail). Confidence: 91. opp_overlap 5291536 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|