Internal ID | 17656604 | Source Database | TransTermHP TERM 29 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 29
|
Sequence |
GGCATGGTCGGTAACGACCATGCC Look for more occurrences |
Start | 145438 |
End | 145461 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGGAAAAAGAAAAAA(5' tail) GGCATGGTCG(5' stem) TTAC(loop) CGACCATGCC(3' stem) TGTTGTCGTCAGCCT(3' tail). Confidence: 100. opp_overlap 145438 145436 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|