| Internal ID | 17656675 | Source Database | TransTermHP TERM 141 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 141
|
| Sequence |
CCCCCGGCCTGAAAAACCGGGGG Look for more occurrences |
| Start | 647160 |
| End | 647182 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGGCAAAGAAAAA(5' tail) CCCCCGG(5' stem) TTTTTCAGG(loop) CCGGGGG(3' stem) TTCGTTCGTCACTCG(3' tail). Confidence: 100. opp_overlap 647160, overlap 647154 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|