Internal ID | 17657194 | Source Database | TransTermHP TERM 979 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 979
|
Sequence |
CCGGGCCGCGGGTAACCGCCGCCCGG Look for more occurrences |
Start | 4357224 |
End | 4357249 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAACGCATCGTACGA(5' tail) CCGGGCCGCGG(5' stem) GTAA(loop) CCGCCGCCCGG(3' stem) TTTTTTCTTGCCCGC(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|