| Internal ID | 17657256 | Source Database | TransTermHP TERM 1074 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1074
|
| Sequence |
CCGCCAGCCTCTTCCGGGGCTGGCGG Look for more occurrences |
| Start | 4704664 |
| End | 4704689 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGAGCGCAAGGAAAA(5' tail) CCGCCAGCCCC(5' stem) GGAA(loop) GAGGCTGGCGG(3' stem) CAGCGGGATCAGATC(3' tail). Confidence: 100. opp_overlap 4704681 4704683, overlap 4704681 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|