Internal ID | 17659706 | Source Database | TransTermHP TERM 549 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 549
|
Sequence |
AGGGACGCCCAAGCGTCCCC Look for more occurrences |
Start | 2166404 |
End | 2166423 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae pv. syringae B728a chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ATGCTCAAAAAGAAA(5' tail) GGGGACGC(5' stem) TTGG(loop) GCGTCCCT(3' stem) TGCGTACGTAAAGAT(3' tail). Confidence: 100. opp_overlap 2166405, overlap 2166405 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|