| Internal ID | 17660653 | Source Database | TransTermHP TERM 507 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 507
|
| Sequence |
GCGGCGCTGAGGCGCAGCGCCGC Look for more occurrences |
| Start | 2143322 |
| End | 2143344 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCAAGAAGGCGGT(5' tail) GCGGCGCTG(5' stem) AGGCG(loop) CAGCGCCGC(3' stem) TCGTCTTGTGAAGTT(3' tail). Confidence: 90. opp_overlap 2143317 2143316 2143308 2143307, overlap 2143316 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|