Internal ID | 17661590 | Source Database | TransTermHP TERM 538 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 538
|
Sequence |
CGGGCCGCCGGTCACCGGCGGCCCG Look for more occurrences |
Start | 2054215 |
End | 2054239 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas protegens Pf-5 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AAAGGCACTGAAAAA(5' tail) CGGGCCGCCGG(5' stem) TCA(loop) CCGGCGGCCCG(3' stem) TTTTTTTGTGGGGTA(3' tail). Confidence: 100. opp_overlap 2054215 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|