Internal ID | 17662949 | Source Database | TransTermHP TERM 1038 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1038
|
Sequence |
GCCCGCGCTGGTCAGTCGCGGGC Look for more occurrences |
Start | 4821842 |
End | 4821864 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACGCAATAAAAAAAA(5' tail) GCCCGCGACT(5' stem) GACC(loop) AG-CGCGGGC(3' stem) TTCTTCATGACGGCC(3' tail). Confidence: 100. gap 1, opp_overlap 4821842 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|