| Internal ID | 17681457 | Source Database | TransTermHP TERM 1025 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1025
|
| Sequence |
CGCGCTCGGGGCCGAGCGCG Look for more occurrences |
| Start | 4101885 |
| End | 4101904 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAAGCAGTCTCAAA(5' tail) CGCGCTCG(5' stem) GCCC(loop) CGAGCGCG(3' stem) CATTCACAATTCGGT(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|