| Internal ID | 17689294 | Source Database | TransTermHP TERM 1226 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1226
|
| Sequence |
GCGTCGCTCCGCTGGACGGCTGC Look for more occurrences |
| Start | 4017265 |
| End | 4017287 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTCATACACTTTTCA(5' tail) GC-GTCGCTCC(5' stem) GCT(loop) GGA-CGGCTGC(3' stem) TTTTTTTCGTTACCC(3' tail). Confidence: 95. overlap 4017267 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|