| Internal ID | 1426313 | Source Database | PseudoCAP 1426313 |
| Feature Type | motif |
| Name |
NalC binding site
|
| Sequence |
AGAACTGTATCGTACAGTACT Look for more occurrences |
| Start | 4166371 |
| End | 4166391 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
EMSA
|
| Additional Comments |
|
Pentachlorophenol induction of the Pseudomonas aeruginosa mexAB-oprM efflux operon: involvement of repressors NalC and MexR and the antirepressor ArmR.
Starr LM, Fruci M, Poole K
PLoS ONE 2012 ;7(2):e32684
PubMed ID: 22393435
|