Internal ID | 1426503 | Source Database | PseudoCAP 1426503 |
Feature Type | motif |
Name |
putative transcription terminator
|
Sequence |
ACGGACACTCCCAAGGGGTGTCCGT Look for more occurrences |
Start | 60176 |
End | 60200 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
|
Additional Comments |
Genetic relationship between the 53- and 49-kilodalton forms of exoenzyme S from Pseudomonas aeruginosa.
Yahr TL, Barbieri JT, Frank DW
J. Bacteriol. 1996 Mar;178(5):1412-9
PubMed ID: 8631719
|