| Internal ID | 1571047 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
LasR binding site
|
| Sequence |
ACCTGCCAGTTCTGGCAGGT Look for more occurrences |
| Start | 4170657 |
| End | 4170676 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,Site directed mutagenesis,Visual sequence inspection
|
| Additional Comments |
|
Analysis of the Pseudomonas aeruginosa elastase (lasB) regulatory region.
Rust L, Pesci EC, Iglewski BH
J. Bacteriol. 1996 Feb;178(4):1134-40
PubMed ID: 8576049
|