| Internal ID | 1572024 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
PvdS binding site
|
| Sequence |
TGAATCGTGCCCGGCCAACGGCGT Look for more occurrences |
| Start | 389176 |
| End | 389199 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,EMSA,qRT-PCR [RNA],Motif-discovery
|
| Additional Comments |
|
The non-classical ArsR-family repressor PyeR (PA4354) modulates biofilm formation in Pseudomonas aeruginosa.
Mac Aogáin M, Mooij MJ, McCarthy RR, Plower E, Wang YP, Tian ZX, Dobson A, Morrissey J, Adams C, O'Gara F
Microbiology (Reading) 2012 Oct;158(Pt 10):2598-2609
PubMed ID: 22820840
|