| Internal ID | 1572027 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
PvdS binding site
|
| Sequence |
TAAATATCCGGATTTTCTTTTCGT Look for more occurrences |
| Start | 1087442 |
| End | 1087465 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
DNA-array expression analysis,Consensus search
|
| Additional Comments |
|
The IHF regulon of exponentially growing Pseudomonas putida cells.
Silva-Rocha R, Chavarría M, Kleijn RJ, Sauer U, de Lorenzo V
Environ. Microbiol. 2013 Jan;15(1):49-63
PubMed ID: 22510163
|