| Internal ID | 17654507 | Source Database | TransTermHP TERM 1450 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1450
|
| Sequence |
GCCCGCGCTGGTCAGTCGCGGGC Look for more occurrences |
| Start | 6700627 |
| End | 6700649 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCCGTCATGAAGAA(5' tail) GCCCGCG-CT(5' stem) GGTC(loop) AGTCGCGGGC(3' stem) TTTTTAATGCATGGA(3' tail). Confidence: 100. gap 1, opp_overlap 6700627 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|