| Internal ID | 17654517 | Source Database | TransTermHP TERM 1463 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1463
|
| Sequence |
GCGCCAGGCTGCCGCCTGGCGG Look for more occurrences |
| Start | 6735795 |
| End | 6735816 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCAACAGATGTGAG(5' tail) GCGCCAGGC(5' stem) TGCC(loop) GCCTGGCGG(3' stem) TTTTTCTCGTATATT(3' tail). Confidence: 100. overlap 6735796 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|