Internal ID | 17654567 | Source Database | TransTermHP TERM 16 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 16
|
Sequence |
CGGACACTCCCAAGGGGTGTCCG Look for more occurrences |
Start | 58934 |
End | 58956 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGTCGACGGCAGAGA(5' tail) CGGACACTCC(5' stem) CAA(loop) GGGGTGTCCG(3' stem) TTTTCATTTGCGCCG(3' tail). Confidence: 100. opp_overlap 58934 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|