Internal ID | 17655708 | Source Database | TransTermHP TERM 171 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 171
|
Sequence |
GGCCCTCCCCACGGAGGGCC Look for more occurrences |
Start | 762530 |
End | 762549 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCACGATACCCGCCA(5' tail) GGCCCTCC(5' stem) CCAC(loop) GGAGGGCC(3' stem) TTTTTTTCGGCGAAC(3' tail). Confidence: 100. opp_overlap 762523 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|