| Internal ID | 17655803 | Source Database | TransTermHP TERM 325 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 325
|
| Sequence |
CGGGGCGCCCAGGGGCGCCCCG Look for more occurrences |
| Start | 1269753 |
| End | 1269774 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGGAGAAAGAGGA(5' tail) CGGGGCGCC(5' stem) CCTG(loop) GGCGCCCCG(3' stem) TTGCTCTTAGCGGCC(3' tail). Confidence: 91. opp_overlap 1269753, overlap 1269748 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|