Internal ID | 17655811 | Source Database | TransTermHP TERM 336 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 336
|
Sequence |
GCCCCTCGCCCCCACGGGCGAGGGGC Look for more occurrences |
Start | 1310655 |
End | 1310680 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCGCAACGAAAGCA(5' tail) GCCCCTCGCCC(5' stem) GTGG(loop) GGGCGAGGGGC(3' stem) TGTCGGGTCAGGCCA(3' tail). Confidence: 100. opp_overlap 1310672, overlap 1310634 1310653 1310652 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|