Internal ID | 17656184 | Source Database | TransTermHP TERM 912 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 912
|
Sequence |
GCCGGAGGCATCGCTGCCTCCGGC Look for more occurrences |
Start | 4037902 |
End | 4037925 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCACGCAAGAAAAA(5' tail) GCCGGAGGCA(5' stem) TCGC(loop) TGCCTCCGGC(3' stem) TTTTTCATGTCCGCG(3' tail). Confidence: 100. opp_overlap 4037902 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|