| Internal ID | 17656190 | Source Database | TransTermHP TERM 919 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 919
|
| Sequence |
GGGCGGGGTAATACCCCGCCC Look for more occurrences |
| Start | 4057549 |
| End | 4057569 |
| Strand | - |
| Genomic Context | Located within gene rsmZ |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAGGCAAAAAAAAG(5' tail) GGGCGGGGT(5' stem) ATT(loop) ACCCCGCCC(3' stem) ACTCTTCAGTCCCTC(3' tail). Confidence: 100. opp_overlap 4057548, overlap 4057548 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|