| Internal ID | 17656558 | Source Database | TransTermHP TERM 1491 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1491
|
| Sequence |
GAACGCCGGCTATCGCCGGCGTTC Look for more occurrences |
| Start | 6047325 |
| End | 6047348 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGCTAGACGCAG(5' tail) GAACGCCGGC(5' stem) TATC(loop) GCCGGCGTTC(3' stem) TTGTTTGCGCGTTCC(3' tail). Confidence: 100. opp_overlap 6047328, overlap 6047322 6047328 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|