| Internal ID | 17656628 | Source Database | TransTermHP TERM 70 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 70
|
| Sequence |
CGGCCGCGTCCGAGGGACGCGGCCG Look for more occurrences |
| Start | 367791 |
| End | 367815 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CATCGACAAACACGA(5' tail) CGGCCGCGTCC(5' stem) CTC(loop) GGACGCGGCCG(3' stem) CTTCCCCCGTTCGGG(3' tail). Confidence: 100. overlap 367788 367786 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|