Internal ID | 17656641 | Source Database | TransTermHP TERM 92 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 92
|
Sequence |
CCGCACCCCGCAAGGGTGCGG Look for more occurrences |
Start | 436293 |
End | 436313 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCGCCTCGCGAAAA(5' tail) CCGCACCC(5' stem) CGCAA(loop) GGGTGCGG(3' stem) TTTTTTTCTGCCCGG(3' tail). Confidence: 100. opp_overlap 436256 436293 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|