| Internal ID | 17656673 | Source Database | TransTermHP TERM 137 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 137
|
| Sequence |
CGCCGGGCCGCACGGCCCGGCG Look for more occurrences |
| Start | 630080 |
| End | 630101 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGGGAGAGGGAGAA(5' tail) CGCCGGGCC(5' stem) GTGC(loop) GGCCCGGCG(3' stem) GGAAGGAATCAGGCG(3' tail). Confidence: 95. opp_overlap 630089 630100 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|