| Internal ID | 17656696 | Source Database | TransTermHP TERM 167 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 167
|
| Sequence |
CCCCTGGTCAGCGATGACCGGGGG Look for more occurrences |
| Start | 738257 |
| End | 738280 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCTCCTATCCCAAAA(5' tail) CCCCTGGTCA(5' stem) GCGA(loop) TGACCGGGGG(3' stem) TTTTGCTTTTGCGCG(3' tail). Confidence: 100. opp_overlap 738257, overlap 738252 738251 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|