| Internal ID | 17657178 | Source Database | TransTermHP TERM 955 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 955
|
| Sequence |
GCCCCTGCCATCGCGGCAGGGGC Look for more occurrences |
| Start | 4198184 |
| End | 4198206 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCGGCAGGAAAAA(5' tail) GCCCCTGCC(5' stem) GCGAT(loop) GGCAGGGGC(3' stem) TTGCCGTTTTGGCCG(3' tail). Confidence: 100. opp_overlap 4198179 4198178 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|