| Internal ID | 17657580 | Source Database | TransTermHP TERM 1554 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1554
|
| Sequence |
GGGACACGGCGACCTGCGGTGTCCC Look for more occurrences |
| Start | 6383828 |
| End | 6383852 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCTCTACACTCTGA(5' tail) GGGACACGGCG(5' stem) ACC(loop) TGCGGTGTCCC(3' stem) TTCTTTTTTTCACCG(3' tail). Confidence: 100. overlap 6383826 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|